Review



its2 reverse primer  (Microsynth ag)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    Microsynth ag its2 reverse primer
    Its2 Reverse Primer, supplied by Microsynth ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/its2 reverse primer/product/Microsynth ag
    Average 90 stars, based on 1 article reviews
    its2 reverse primer - by Bioz Stars, 2026-02
    90/100 stars

    Images



    Similar Products

    its2 reverse primer  (Microsynth ag)
    90
    Microsynth ag its2 reverse primer
    Its2 Reverse Primer, supplied by Microsynth ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/its2 reverse primer/product/Microsynth ag
    Average 90 stars, based on 1 article reviews
    its2 reverse primer - by Bioz Stars, 2026-02
    90/100 stars
    		  Buy from Supplier
    its2 reverse primer  (Illumina Inc)
    90
    Illumina Inc its2 reverse primer
    Symbiodiniaceae communities along the environmental gradient. (a) NMDS of Wisconsin double standardized and 4th square‐root transformed <t>ITS2</t> sequence abundance data. Colonies are colored by sampling site, and arrows represent ITS2 sequences. (b) Predicted relative abundance of Symbiodiniaceae ITS2 type profiles for each colony.
    Its2 Reverse Primer, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/its2 reverse primer/product/Illumina Inc
    Average 90 stars, based on 1 article reviews
    its2 reverse primer - by Bioz Stars, 2026-02
    90/100 stars
    		  Buy from Supplier
    its2 reverse primer (5'- gctgcgttcttcatcgatgc-3)  (Thermo Fisher)
    90
    Thermo Fisher its2 reverse primer (5'- gctgcgttcttcatcgatgc-3)
    Symbiodiniaceae communities along the environmental gradient. (a) NMDS of Wisconsin double standardized and 4th square‐root transformed <t>ITS2</t> sequence abundance data. Colonies are colored by sampling site, and arrows represent ITS2 sequences. (b) Predicted relative abundance of Symbiodiniaceae ITS2 type profiles for each colony.
    Its2 Reverse Primer (5' Gctgcgttcttcatcgatgc 3), supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/its2 reverse primer (5'- gctgcgttcttcatcgatgc-3)/product/Thermo Fisher
    Average 90 stars, based on 1 article reviews
    its2 reverse primer (5'- gctgcgttcttcatcgatgc-3) - by Bioz Stars, 2026-02
    90/100 stars
    		  Buy from Supplier
    primers itsintfor2 and its2-reverse  (Illumina Inc)
    90
    Illumina Inc primers itsintfor2 and its2-reverse
    Symbiodiniaceae communities along the environmental gradient. (a) NMDS of Wisconsin double standardized and 4th square‐root transformed <t>ITS2</t> sequence abundance data. Colonies are colored by sampling site, and arrows represent ITS2 sequences. (b) Predicted relative abundance of Symbiodiniaceae ITS2 type profiles for each colony.
    Primers Itsintfor2 And Its2 Reverse, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/primers itsintfor2 and its2-reverse/product/Illumina Inc
    Average 90 stars, based on 1 article reviews
    primers itsintfor2 and its2-reverse - by Bioz Stars, 2026-02
    90/100 stars
    		  Buy from Supplier
    its2-reverse primer  (Illumina Inc)
    90
    Illumina Inc its2-reverse primer
    Symbiodiniaceae communities along the environmental gradient. (a) NMDS of Wisconsin double standardized and 4th square‐root transformed <t>ITS2</t> sequence abundance data. Colonies are colored by sampling site, and arrows represent ITS2 sequences. (b) Predicted relative abundance of Symbiodiniaceae ITS2 type profiles for each colony.
    Its2 Reverse Primer, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/its2-reverse primer/product/Illumina Inc
    Average 90 stars, based on 1 article reviews
    its2-reverse primer - by Bioz Stars, 2026-02
    90/100 stars
    		  Buy from Supplier
    primers itsintfor2 and its2-reverse with illumina sequencing adapters  (Illumina Inc)
    90
    Illumina Inc primers itsintfor2 and its2-reverse with illumina sequencing adapters
    Symbiodiniaceae communities along the environmental gradient. (a) NMDS of Wisconsin double standardized and 4th square‐root transformed <t>ITS2</t> sequence abundance data. Colonies are colored by sampling site, and arrows represent ITS2 sequences. (b) Predicted relative abundance of Symbiodiniaceae ITS2 type profiles for each colony.
    Primers Itsintfor2 And Its2 Reverse With Illumina Sequencing Adapters, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/primers itsintfor2 and its2-reverse with illumina sequencing adapters/product/Illumina Inc
    Average 90 stars, based on 1 article reviews
    primers itsintfor2 and its2-reverse with illumina sequencing adapters - by Bioz Stars, 2026-02
    90/100 stars
    		  Buy from Supplier
    reverse primer (its2  (Illumina Inc)
    90
    Illumina Inc reverse primer (its2
    Symbiodiniaceae communities along the environmental gradient. (a) NMDS of Wisconsin double standardized and 4th square‐root transformed <t>ITS2</t> sequence abundance data. Colonies are colored by sampling site, and arrows represent ITS2 sequences. (b) Predicted relative abundance of Symbiodiniaceae ITS2 type profiles for each colony.
    Reverse Primer (Its2, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/reverse primer (its2/product/Illumina Inc
    Average 90 stars, based on 1 article reviews
    reverse primer (its2 - by Bioz Stars, 2026-02
    90/100 stars
    		  Buy from Supplier
    forward its1-f (cttggtcatttagaggaagtaa) reverse its2 (gctgcgttcttcatcgatgc) primers  (Millipore)
    90
    Millipore forward its1-f (cttggtcatttagaggaagtaa) reverse its2 (gctgcgttcttcatcgatgc) primers
    Symbiodiniaceae communities along the environmental gradient. (a) NMDS of Wisconsin double standardized and 4th square‐root transformed <t>ITS2</t> sequence abundance data. Colonies are colored by sampling site, and arrows represent ITS2 sequences. (b) Predicted relative abundance of Symbiodiniaceae ITS2 type profiles for each colony.
    Forward Its1 F (Cttggtcatttagaggaagtaa) Reverse Its2 (Gctgcgttcttcatcgatgc) Primers, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/forward its1-f (cttggtcatttagaggaagtaa) reverse its2 (gctgcgttcttcatcgatgc) primers/product/Millipore
    Average 90 stars, based on 1 article reviews
    forward its1-f (cttggtcatttagaggaagtaa) reverse its2 (gctgcgttcttcatcgatgc) primers - by Bioz Stars, 2026-02
    90/100 stars
    		  Buy from Supplier
    primer its2-2043r (gctgcgttcttcatcgatgc) + reverse primer  (Illumina Inc)
    90
    Illumina Inc primer its2-2043r (gctgcgttcttcatcgatgc) + reverse primer
    Symbiodiniaceae communities along the environmental gradient. (a) NMDS of Wisconsin double standardized and 4th square‐root transformed <t>ITS2</t> sequence abundance data. Colonies are colored by sampling site, and arrows represent ITS2 sequences. (b) Predicted relative abundance of Symbiodiniaceae ITS2 type profiles for each colony.
    Primer Its2 2043r (Gctgcgttcttcatcgatgc) + Reverse Primer, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/primer its2-2043r (gctgcgttcttcatcgatgc) + reverse primer/product/Illumina Inc
    Average 90 stars, based on 1 article reviews
    primer its2-2043r (gctgcgttcttcatcgatgc) + reverse primer - by Bioz Stars, 2026-02
    90/100 stars
    		  Buy from Supplier
    its1 forward and illumina barcoded its2 reverse primers  (Illumina Inc)
    90
    Illumina Inc its1 forward and illumina barcoded its2 reverse primers
    Symbiodiniaceae communities along the environmental gradient. (a) NMDS of Wisconsin double standardized and 4th square‐root transformed <t>ITS2</t> sequence abundance data. Colonies are colored by sampling site, and arrows represent ITS2 sequences. (b) Predicted relative abundance of Symbiodiniaceae ITS2 type profiles for each colony.
    Its1 Forward And Illumina Barcoded Its2 Reverse Primers, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/its1 forward and illumina barcoded its2 reverse primers/product/Illumina Inc
    Average 90 stars, based on 1 article reviews
    its1 forward and illumina barcoded its2 reverse primers - by Bioz Stars, 2026-02
    90/100 stars
    		  Buy from Supplier

    Image Search Results


    Symbiodiniaceae communities along the environmental gradient. (a) NMDS of Wisconsin double standardized and 4th square‐root transformed ITS2 sequence abundance data. Colonies are colored by sampling site, and arrows represent ITS2 sequences. (b) Predicted relative abundance of Symbiodiniaceae ITS2 type profiles for each colony.

    Journal: Global Change Biology

    Article Title: Rapid Evolution in Action: Environmental Filtering Supports Coral Adaptation to a Hot, Acidic, and Deoxygenated Extreme Habitat

    doi: 10.1111/gcb.70103

    Figure Lengend Snippet: Symbiodiniaceae communities along the environmental gradient. (a) NMDS of Wisconsin double standardized and 4th square‐root transformed ITS2 sequence abundance data. Colonies are colored by sampling site, and arrows represent ITS2 sequences. (b) Predicted relative abundance of Symbiodiniaceae ITS2 type profiles for each colony.

    Article Snippet: We used ITS2 forward (5’‐TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGTGAATTGCAGAACTCCGTG‐3′) and ITS2 Reverse (5′‐GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGCCTCCGCTTACTTATATGCTT‐3) Illumina‐tagged primers from Hume et al. (Hume et al. ) to amplify the ITS2 gene using DreamGreen PCR master mix (ThermoFisher Cat no. K1081) for a total of 35 PCR cycles.

    Techniques: Transformation Assay, Sequencing, Sampling